Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 1997120
End position: 1997179
Length: 60

DNA sequence
>NC_002973, from 1997120 to 1997179 (60 bp); Listeria monocytogenes str. 4b F2365 TCTTGTTTTTTCTTATCTGCCGCAGCTTTTTCTTCGGCAGCTTTTTTCTCTTCAGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1996799-1997533	Sequence	LMOf2365_1970 - lysM domain-containing protein (Protein is coded in complementary strand; from 1997533 to 1996799)