Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 2082536
End position: 2082568
Length: 33

DNA sequence
>NC_002973, from 2082536 to 2082568 (33 bp); Listeria monocytogenes str. 4b F2365 GAAGTCATTTACTTCGTCTTCGTCATAACCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2082093-2082620	Sequence	LMOf2365_2045 divIVA cell division protein DivIVA (Protein is coded in complementary strand; from 2082620 to 2082093)