Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 2363275
End position: 2363298
Length: 24

DNA sequence
>NC_002973, from 2363275 to 2363298 (24 bp); Listeria monocytogenes str. 4b F2365 AGATTCGAGTGTTCGCGCGGCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2363210-2364328	Sequence	LMOf2365_2311 - carbohydrate kinase (Protein is coded in complementary strand; from 2364328 to 2363210)