Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 2370964
End position: 2370993
Length: 30

DNA sequence
>NC_002973, from 2370964 to 2370993 (30 bp); Listeria monocytogenes str. 4b F2365 CAAAGTAGACCTCATAACCGCGGCGTAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2370867-2371403	Sequence	LMOf2365_2320 - acetyltransferase (Protein is coded in complementary strand; from 2371403 to 2370867)