Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 2431029
End position: 2431052
Length: 24

DNA sequence
>NC_002973, from 2431029 to 2431052 (24 bp); Listeria monocytogenes str. 4b F2365 AAAAAGCCTTTGAGACGGAGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2430915-2431190	Sequence	LMOf2365_2376 - hypothetical protein (Protein is coded in complementary strand; from 2431190 to 2430915)