Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 2709788
End position: 2709811
Length: 24

DNA sequence
>NC_002973, from 2709788 to 2709811 (24 bp); Listeria monocytogenes str. 4b F2365 TTTCTATTAAATTAGTAAAACTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2708878-2710563	Sequence	LMOf2365_2662 kdpA potassium-transporting ATPase subunit A (Protein is coded in complementary strand; from 2710563 to 2708878)