Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 358095
End position: 358149
Length: 55

DNA sequence
>NC_002973, from 358095 to 358149 (55 bp); Listeria monocytogenes str. 4b F2365 AATCAGATTCTACTACCGTTGATTCTGGATTTTCTGGAGTGGTGATTTCTGGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 357848-359116	Sequence	LMOf2365_0338 - cell wall surface anchor family protein (Protein is coded in complementary strand; from 359116 to 357848)