Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 626099
End position: 626122
Length: 24

DNA sequence
>NC_002973, from 626099 to 626122 (24 bp); Listeria monocytogenes str. 4b F2365 GCTTTAGGTGCTGTTTGTTGTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 625556-626989	Sequence	LMOf2365_0611 iap invasion associated secreted endopeptidase (Protein is coded in complementary strand; from 626989 to 625556)