Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 675547
End position: 675582
Length: 36

DNA sequence
>NC_002973, from 675547 to 675582 (36 bp); Listeria monocytogenes str. 4b F2365 AGTACTATTATTCTTAGGTCTACACCTTAGAAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 670836-675596	Sequence	LMOf2365_0656 - cell wall surface anchor family protein