Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 724907
End position: 724946
Length: 40

DNA sequence
>NC_002973, from 724907 to 724946 (40 bp); Listeria monocytogenes str. 4b F2365 TCTTTGGAAAAATCCGCAAATCATTTAGGCTGAGCATTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 724321-725241	Sequence	LMOf2365_0710 - hypothetical protein (Protein is coded in complementary strand; from 725241 to 724321)