Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 957338
End position: 957361
Length: 24

DNA sequence
>NC_002973, from 957338 to 957361 (24 bp); Listeria monocytogenes str. 4b F2365 TGGAAAACGCCTAAACAACAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 956725-958296	Sequence	LMOf2365_0941 - ABC transporter ATP-binding protein