Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhi
Start position: 3325015
End position: 3325038
Length: 24

DNA sequence
>NC_003198, from 3325015 to 3325038 (24 bp); Salmonella enterica subsp. enterica serovar Typhi TCGCTTTCGCTTTCTCTTCCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3324741-3325913	Sequence	STY3480 - GTP-binding protein (Protein is coded in complementary strand; from 3325913 to 3324741)