Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhi
Start position: 1070418
End position: 1070442
Length: 25

DNA sequence
>NC_003198, from 1070418 to 1070442 (25 bp); Salmonella enterica subsp. enterica serovar Typhi CCGGAGCCGGAGCCGGTGCCGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1070003-1071055	Sequence	STY1091 - outer membrane protein A (Protein is coded in complementary strand; from 1071055 to 1070003)