Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhi
Start position: 2308442
End position: 2308468
Length: 27

DNA sequence
>NC_003198, from 2308442 to 2308468 (27 bp); Salmonella enterica subsp. enterica serovar Typhi GCAGCGCCAGCAGCGCCAGCGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2308342-2308554	Sequence	STY2477 ccmD1 heme exporter protein D1 (Protein is coded in complementary strand; from 2308554 to 2308342)