Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhi
Start position: 3302850
End position: 3302876
Length: 27

DNA sequence
>NC_003198, from 3302850 to 3302876 (27 bp); Salmonella enterica subsp. enterica serovar Typhi CGCGCGACCGGCGCGACCCGCACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3301996-3303936	Sequence	STY3461 - ATP-dependent RNA helicase (Protein is coded in complementary strand; from 3303936 to 3301996)