Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhi
Start position: 3832278
End position: 3832304
Length: 27

DNA sequence
>NC_003198, from 3832278 to 3832304 (27 bp); Salmonella enterica subsp. enterica serovar Typhi TGGCGCCGCTGGCGCTGCTGGCGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3832194-3832406	Sequence	STY3962 ccmD2 heme exporter protein D2