Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhi
Start position: 3872216
End position: 3872243
Length: 28

DNA sequence
>NC_003198, from 3872216 to 3872243 (28 bp); Salmonella enterica subsp. enterica serovar Typhi GCGCCCGGCGCGCCAGGCGCGCACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3871470-3872852	Sequence	STY4009 - glycosyl hydrolase (Protein is coded in complementary strand; from 3872852 to 3871470)