Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhi
Start position: 4624283
End position: 4624310
Length: 28

DNA sequence
>NC_003198, from 4624283 to 4624310 (28 bp); Salmonella enterica subsp. enterica serovar Typhi TCGTCACGCGTCACGCGTCACGCGTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4624308-4624946	Sequence	STY4767 msrA peptide methionine sulfoxide reductase (Protein is coded in complementary strand; from 4624946 to 4624308)