Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhi
Start position: 1146208
End position: 1146237
Length: 30

DNA sequence
>NC_003198, from 1146208 to 1146237 (30 bp); Salmonella enterica subsp. enterica serovar Typhi ACGAAAAATAACCAGAAATAACAAAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1145268-1146422	Sequence	STY1186 - glucans biosynthesis protein (Protein is coded in complementary strand; from 1146422 to 1145268)