Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhi
Start position: 2532442
End position: 2532471
Length: 30

DNA sequence
>NC_003198, from 2532442 to 2532471 (30 bp); Salmonella enterica subsp. enterica serovar Typhi ACGCCGTCGCACGCCGCCTCACGCAGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2531584-2532771	Sequence	STY2698 eutG alchohol dehydrogenase (Protein is coded in complementary strand; from 2532771 to 2531584)