Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Typhi
Start position: 666036
End position: 666092
Length: 57

DNA sequence
>NC_003198, from 666036 to 666092 (57 bp); Salmonella enterica subsp. enterica serovar Typhi TACCAGTACCAGTACCAGTACCAGTACCAGTACCAGTACCAGTACCAGTACCAGTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 665734-667239	Sequence	STY0667 citT citrate carrier (Protein is coded in complementary strand; from 667239 to 665734)