Sequence retrieval

Genome: Pyrococcus furiosus DSM 3638
Start position: 1099490
End position: 1099515
Length: 26

DNA sequence
>NC_003413, from 1099490 to 1099515 (26 bp); Pyrococcus furiosus DSM 3638 TTTAATTATTTAATTATGTAATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1099298-1099495	Sequence	PF1146 - hypothetical protein
ORF... 1099504-1100967	Sequence	PF1147 - monovalent cation/H+ antiporter subunit D (Protein is coded in complementary strand; from 1100967 to 1099504)