Sequence retrieval

Genome: Pyrococcus furiosus DSM 3638
Start position: 1168011
End position: 1168034
Length: 24

DNA sequence
>NC_003413, from 1168011 to 1168034 (24 bp); Pyrococcus furiosus DSM 3638 TGTGGTTGTGGATGTTGTTGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1166614-1168767	Sequence	PF1233 - chitinase (Protein is coded in complementary strand; from 1168767 to 1166614)