Sequence retrieval

Genome: Pyrococcus furiosus DSM 3638
Start position: 467942
End position: 467967
Length: 26

DNA sequence
>NC_003413, from 467942 to 467967 (26 bp); Pyrococcus furiosus DSM 3638 CCTTTTTCTTTTCCTTGTCTTTTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 467898-469481	Sequence	PF0453 - hypothetical protein (Protein is coded in complementary strand; from 469481 to 467898)