Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 2053150
End position: 2053173
Length: 24

DNA sequence
>NC_004088, from 2053150 to 2053173 (24 bp); Yersinia pestis KIM GTAACAGTAACGATAACAGTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2052608-2053150	Sequence	y1861 - hypothetical protein (Protein is coded in complementary strand; from 2053150 to 2052608)
ORF. 2053144-2053698	Sequence	y1862 - hypothetical protein (Protein is coded in complementary strand; from 2053698 to 2053144)