Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 3601292
End position: 3601315
Length: 24

DNA sequence
>NC_004088, from 3601292 to 3601315 (24 bp); Yersinia pestis KIM GGCTTTGTCTTTGGGTTTGGCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3600129-3601343	Sequence	y3271 - integrase (Protein is coded in complementary strand; from 3601343 to 3600129)