Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 4595190
End position: 4595213
Length: 24

DNA sequence
>NC_004088, from 4595190 to 4595213 (24 bp); Yersinia pestis KIM TTCAGCTTCTGCTTTAGCTTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4595005-4595475	Sequence	y4139 atpF ATP synthase F0F1 subunit B (Protein is coded in complementary strand; from 4595475 to 4595005)