Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 698500
End position: 698523
Length: 24

DNA sequence
>NC_004088, from 698500 to 698523 (24 bp); Yersinia pestis KIM TAAACCAAAACCCAAACCTAAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 697928-701287	Sequence	y0619 - hypothetical protein (Protein is coded in complementary strand; from 701287 to 697928)