Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 1103260
End position: 1103285
Length: 26

DNA sequence
>NC_004088, from 1103260 to 1103285 (26 bp); Yersinia pestis KIM GCTGTTGCTCTTGCTGATGTTGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1102023-1105712	Sequence	y0976 sbcC ATP-dependent dsDNA exonuclease (Protein is coded in complementary strand; from 1105712 to 1102023)