Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 3700271
End position: 3700297
Length: 27

DNA sequence
>NC_004088, from 3700271 to 3700297 (27 bp); Yersinia pestis KIM ATCACTTTCCTCACTTTCCTCACTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3700005-3700394	Sequence	y3359 - hypothetical protein (Protein is coded in complementary strand; from 3700394 to 3700005)