Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 3847134
End position: 3847164
Length: 31

DNA sequence
>NC_004088, from 3847134 to 3847164 (31 bp); Yersinia pestis KIM CTGCGCCTGGCTGCGGCTGACGGCGGCTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3846490-3848130	Sequence	y3464 fliF flagellar MS-ring protein (Protein is coded in complementary strand; from 3848130 to 3846490)