Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 1071489
End position: 1071520
Length: 32

DNA sequence
>NC_004088, from 1071489 to 1071520 (32 bp); Yersinia pestis KIM CCACTGGCTCACTGGCTCACTGGCTCACTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1070831-1071493	Sequence	y0949 - hypothetical protein (Protein is coded in complementary strand; from 1071493 to 1070831)