Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 2220681
End position: 2220716
Length: 36

DNA sequence
>NC_004088, from 2220681 to 2220716 (36 bp); Yersinia pestis KIM ACTGCTGGTGCTGGTGCTGGTGCTGGTGCTGGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2220516-2220824	Sequence	y2014 asr acid shock protein (Protein is coded in complementary strand; from 2220824 to 2220516)
ORF. 2220671-2220826	Sequence	y2015 - hypothetical protein