Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 1993020
End position: 1993064
Length: 45

DNA sequence
>NC_004088, from 1993020 to 1993064 (45 bp); Yersinia pestis KIM CATTGGCATATTGAACATTGGCATATTGAACATTGGCATATTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1992898-1993059	Sequence	y1814 - hypothetical protein (Protein is coded in complementary strand; from 1993059 to 1992898)