Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 2814844
End position: 2814888
Length: 45

DNA sequence
>NC_004088, from 2814844 to 2814888 (45 bp); Yersinia pestis KIM GTTGATACAACAACTGTTGATACAACAACTGTTACTAAAACAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2814833-2815720	Sequence	y2553 manZ PTS system mannose-specific transporter subunit IID