Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 1408498
End position: 1408543
Length: 46

DNA sequence
>NC_004088, from 1408498 to 1408543 (46 bp); Yersinia pestis KIM TATTTTCAGTATCAATATTGTTGGTATCAATATTGTCGGCATCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1408485-1411211	Sequence	y1262 kdpD sensor protein KdpD (Protein is coded in complementary strand; from 1411211 to 1408485)