Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 1932455
End position: 1932500
Length: 46

DNA sequence
>NC_004088, from 1932455 to 1932500 (46 bp); Yersinia pestis KIM GCGTTATCACGACTGGTGTTATCACGGTTGGTGTTATCGCGGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1930742-1934392	Sequence	y1749 rne ribonuclease E (Protein is coded in complementary strand; from 1934392 to 1930742)