Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 2339208
End position: 2339253
Length: 46

DNA sequence
>NC_004088, from 2339208 to 2339253 (46 bp); Yersinia pestis KIM CGATAGTTGCAGAACCGATGGCTGTAGAACCGATAGCTGCAGAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2338233-2339666	Sequence	y2121 - virulence factor
ORF. 2339168-2339329	Sequence	y2120 - hypothetical protein (Protein is coded in complementary strand; from 2339329 to 2339168)