Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 3840584
End position: 3840629
Length: 46

DNA sequence
>NC_004088, from 3840584 to 3840629 (46 bp); Yersinia pestis KIM TTTGAGCTGATGACATTTGGGTTGATAACATTTGAGCGGATGATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3840373-3840819	Sequence	y3456 flgB flagellar basal-body rod protein FlgB (Protein is coded in complementary strand; from 3840819 to 3840373)