Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 4385625
End position: 4385670
Length: 46

DNA sequence
>NC_004088, from 4385625 to 4385670 (46 bp); Yersinia pestis KIM TAGAAGGCCATCATGCAGAAGGCCATGATATCGACGGTCATCATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4385157-4385690	Sequence	y3927 - hypothetical protein
ORF... 4385638-4386264	Sequence	y3928 - hypothetical protein