Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 705968
End position: 706013
Length: 46

DNA sequence
>NC_004088, from 705968 to 706013 (46 bp); Yersinia pestis KIM AGTCATGTTGTTCTAAGTCATGGAGCTCTAAGTCATGGCGATCTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 705181-706416	Sequence	y0624 - hypothetical protein (Protein is coded in complementary strand; from 706416 to 705181)