Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 1698147
End position: 1698193
Length: 47

DNA sequence
>NC_004088, from 1698147 to 1698193 (47 bp); Yersinia pestis KIM GTACAGGTTGCAACTGTGCCGATTGCAACTGTAACGGCTGCAACTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1697921-1698991	Sequence	y1534 - hypothetical protein (Protein is coded in complementary strand; from 1698991 to 1697921)