Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 1658077
End position: 1658124
Length: 48

DNA sequence
>NC_004088, from 1658077 to 1658124 (48 bp); Yersinia pestis KIM TTTTTGAGCCGTTTGTTTATGAACCATTTGTTTATGAACAGTTTGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1657784-1658395	Sequence	y1496 - hypothetical protein (Protein is coded in complementary strand; from 1658395 to 1657784)