Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 1893590
End position: 1893637
Length: 48

DNA sequence
>NC_004088, from 1893590 to 1893637 (48 bp); Yersinia pestis KIM CGATTTTAAAGCCCTAAGATTTTAAAACGCTAGGATTTTAAAGTCCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1892171-1893607	Sequence	y1712 - solute-binding periplasmic protein of ABC transporter