Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 260825
End position: 260872
Length: 48

DNA sequence
>NC_004088, from 260825 to 260872 (48 bp); Yersinia pestis KIM TTGGAGATGATTGGTTTGAAGATGATGGCTTTGAAGATGATGGCTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 260746-261882	Sequence	y0245 ssuA alkanesulfonate transporter substrate-binding subunit (Protein is coded in complementary strand; from 261882 to 260746)