Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 3101099
End position: 3101146
Length: 48

DNA sequence
>NC_004088, from 3101099 to 3101146 (48 bp); Yersinia pestis KIM TGTCGATTGGCCATATGTTGATTGCCCGTATGTTGATTGACCATATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3099402-3103319	Sequence	y2800 ftsK cell division protein (Protein is coded in complementary strand; from 3103319 to 3099402)
ORF. 3101084-3101320	Sequence	y2799 - hypothetical protein