Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 178443
End position: 178491
Length: 49

DNA sequence
>NC_004088, from 178443 to 178491 (49 bp); Yersinia pestis KIM AGTGTATTCATCAAACAATGCATTCATCAAACAATGCATTTATCAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 178486-178767	Sequence	y0173 - hypothetical protein (Protein is coded in complementary strand; from 178767 to 178486)