Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 4386964
End position: 4387012
Length: 49

DNA sequence
>NC_004088, from 4386964 to 4387012 (49 bp); Yersinia pestis KIM AATGTCTCATCAAGTAATATCTCACCAAATAATGCCTCATCCAGTAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4386661-4387050	Sequence	y3931 - hypothetical protein (Protein is coded in complementary strand; from 4387050 to 4386661)