Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 944294
End position: 944343
Length: 50

DNA sequence
>NC_004088, from 944294 to 944343 (50 bp); Yersinia pestis KIM ATTAACGGGTGATGACATTAATAGATGATGACATTAATAGGTGATTACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 944339-945628	Sequence	y0844 arsB arsenical pump membrane protein (Protein is coded in complementary strand; from 945628 to 944339)