Sequence retrieval

Genome: Yersinia pestis KIM
Start position: 1035944
End position: 1035994
Length: 51

DNA sequence
>NC_004088, from 1035944 to 1035994 (51 bp); Yersinia pestis KIM TTCATACATTAGCCTTTATCATATGTTAGCCTTTATCATACATTAGCCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1035512-1035949	Sequence	y0919 trxC thioredoxin (Protein is coded in complementary strand; from 1035949 to 1035512)